... implying that the enzymes involved in heavy chain class switches participate in translocations. Fortuitous S-like sequences may also influence the sites of recombination within ...

... indi- cate that the RTases encoded by the class II retrotransposons and retroelements (called here type 2 RTases) are more like one another in predicted amino acid sequence than they are like the RTases (type 1) ...

... group psychotherapy. Its planned syllabus, regular number and sequence of sessions, combination of lectures followed by discussion, and heterogeneous composition tend to make it class-like, The informal atmosphere, attempt +-o draw out patients, ...

... 86 nt long, is synthesized from the short class II] transcriptional unit located on the 5'-side of the Alu repeat (3). This location coincides with the location of the HY3-like DNA sequence. promoter? GTGG-CNNAGTGG HY3 GGCTGGTCCGAGTGCAGTGGTGTTTACAACTAAT TGATCACAACCAGTTA 50 ERKEKKES | ...

... 86 nt long, is synthesized from the short class II] transcriptional unit located on the 5'-side of the Alu repeat (3). This location coincides with the location of the HY3-like DNA sequence. promoter? GTGG-CNNAGTGG HY3 GGCTGGTCCGAGTGCAGTGGTGTTTACAACTAAT TGATCACAACCAGTTA 50 ERKEKKES | ...

... and their accommodations, including the table, are first-class, and they are not yet crowded, like most of the older lines of Atlantic steamers—a circumstance of no little con- sequence to the invalid, especially when he is accompanied ...

... circumstances. These refer chiefly to that uni- form sequence of events from which we derive our idea of the one being the cause of the other. But the class like- wise includes other relations arising out of the ...

... from real-world data comparing multiple treatment options, sequences, and ... within-class comparisons could be performed to identify advantages for ...

... immunomodulators could be compared to other systemic therapies like ... sequences of targeted immunomodulator therapy should be evaluated to ...

... us that we cannot aid as we would like correspondents of this class. Here is another from a young man who wants the same information because he is anxious to marry but cannot afford to do so if paternity must be a sequence. He says: " It is not because I do ...