Skip to main content
U.S. flag

An official website of the United States government

Official websites use .gov
A .gov website belongs to an official government organization in the United States.

Secure .gov websites use HTTPS
A lock ( ) or https:// means you’ve safely connected to the .gov website. Share sensitive information only on official, secure websites.

Search help
89 results
  1. pdfaug96.pdf 
    https://www.ncbi.nlm.nih.gov/books/NBK2592/bin/aug96.pdf
    ... organism] title DNA Sequence File >eIF4E Drosophila melanogaster eukaryotic initiation factors 4E-I and 4E-II (eIF4E) gene CGGTTGCTTGGGTTTTATAACATCAGTCAGTGACAGGCATTTCCAGA ...
  2. 2019New_Mesh_Tree_Hierarchy.txt 
    https://www.nlm.nih.gov/.../download/2019New_Mesh_Tree_Hierarchy.txt
    ... D08.811.913.696.445.735.720.500 Eukaryotic Initiation Factor-4A D08.811.913.696.445.735.780 ... Chimerin 1 D12.644.360.325.150.300 Eukaryotic Initiation Factor-5 D12.644.360.325.150.500 ras ...
  3. pdf2017MeshTreesWithChangesShown.pdf 
    https://www.nlm.nih.gov/.../2017MeshTreesWithChangesShown.pdf
    ... DEAD Box Protein 58 Interferon-Induced Helicase, IFIH1 Eukaryotic Initiation Factor-4A RNA Replicase RNA, Ribosomal, Self-Splicing Sulfate ... Regulators GTPase-Activating Proteins Chimerin Proteins Chimerin 1 Eukaryotic Initiation Factor-5 ras GTPase-Activating Proteins Neurofibromin 1 p120 ...
  4. pdf2016MeshTree.pdf 
    https://www.nlm.nih.gov/mesh/2016/download/2016MeshTree.pdf
    ... D08.811.913.696.445.735.720.500...........................................Eukaryotic Initiation Factor-4A D08.811.913.696.445.735.780........................................... ...
  5. EIF2B4 gene: MedlinePlus Genetics 
    https://medlineplus.gov/genetics/gene/eif2b4
    ... vanishing white matter impair the function of the eukaryotic initiation factor 2B complex in diverse ways. Mol Cell Biol. ...
  6. EIF2B5 gene: MedlinePlus Genetics 
    https://medlineplus.gov/genetics/gene/eif2b5
    ... vanishing white matter impair the function of the eukaryotic initiation factor 2B complex in diverse ways. Mol Cell Biol. ...
  7. EIF2B3 gene: MedlinePlus Genetics 
    https://medlineplus.gov/genetics/gene/eif2b3
    ... vanishing white matter impair the function of the eukaryotic initiation factor 2B complex in diverse ways. Mol Cell Biol. ...
  8. EIF2B1 gene: MedlinePlus Genetics 
    https://medlineplus.gov/genetics/gene/eif2b1
    ... vanishing white matter impair the function of the eukaryotic initiation factor 2B complex in diverse ways. Mol Cell Biol. ...
  9. xmlghr-summaries.xml 
    https://medlineplus.gov/download/ghr-summaries.xml
    ... gene-summary ><gene-symbol >EIF2AK4</gene-symbol><name >eukaryotic translation initiation factor 2 alpha kinase 4</name><ghr-page >https:// ... list><synonym-list ><synonym >E2AK4_HUMAN</synonym><synonym >eukaryotic ... factor 2-alpha kinase 4</synonym><synonym >GCN2</synonym>< ...
  10. Genes: E 
    https://medlineplus.gov/genetics/gene-e
    ... 1 EHMT1 : euchromatic histone lysine methyltransferase 1 EIF2AK4 : eukaryotic translation initiation factor 2 alpha kinase 4 EIF2B5 : eukaryotic translation initiation ...
first · previous · 1 · 2 · 3 · 4 · 5 · 6 · 7 · 8 · next · last