Skip to main content
U.S. flag

An official website of the United States government

Official websites use .gov
A .gov website belongs to an official government organization in the United States.

Secure .gov websites use HTTPS
A lock ( ) or https:// means you’ve safely connected to the .gov website. Share sensitive information only on official, secure websites.

7,865 results
  1. ... implying that the enzymes involved in heavy chain class switches participate in translocations. Fortuitous S-like sequences may also influence the sites of recombination within ...
  2. NLM Digital Collections - Minireview: Unusual Reverse Transcriptases 
    Publication: American Society for Biochemistry and Molecular Biology, 20 October 1995
    ... indi- cate that the RTases encoded by the class II retrotransposons and retroelements (called here type 2 RTases) are more like one another in predicted amino acid sequence than they are like the RTases (type 1) ...
  3. NLM Digital Collections - Annual report of Program Placement and Psychological Branch, Convalescent Services Division, .... 
    Publication: Miami Beach, Florida : Army Air Forces Regional and Convalescent Hospital, Miami District
    ... group psychotherapy. Its planned syllabus, regular number and sequence of sessions, combination of lectures followed by discussion, and heterogeneous composition tend to make it class-like, The informal atmosphere, attempt +-o draw out patients, ...
  4. ... circumstances. These refer chiefly to that uni- form sequence of events from which we derive our idea of the one being the cause of the other. But the class like- wise includes other relations arising out of the ...
  5. ... proposed plant homologue of connexin is protein kinase-like protein. Plant Cell 1993:5:998-9. Oppenheim AB, Rudd KE, Mendelson I. Teff D. Integration host factor binds to a unique class of complex repetitive extragenic DNA sequences in Escherichia coli. MolMicrobiol 1993;10(1):113- ...
  6. ... 86 nt long, is synthesized from the short class II] transcriptional unit located on the 5'-side of the Alu repeat (3). This location coincides with the location of the HY3-like DNA sequence. promoter? GTGG-CNNAGTGG HY3 GGCTGGTCCGAGTGCAGTGGTGTTTACAACTAAT TGATCACAACCAGTTA 50 ERKEKKES | ...
  7. ... 86 nt long, is synthesized from the short class II] transcriptional unit located on the 5'-side of the Alu repeat (3). This location coincides with the location of the HY3-like DNA sequence. promoter? GTGG-CNNAGTGG HY3 GGCTGGTCCGAGTGCAGTGGTGTTTACAACTAAT TGATCACAACCAGTTA 50 ERKEKKES | ...
  8. NLM Digital Collections - Targeted immunomodulators for the treatment of moderate-to-severe plaque psoriasis : ... 
    Publication: Boston, MA : Institute for Clinical and Economic Review, December 2 2016
    ... immunomodulators could be compared to other systemic therapies like ... sequences of targeted immunomodulator therapy should be evaluated to ...
  9. NLM Digital Collections - Targeted immunomodulators for the treatment of moderate-to-severe plaque psoriasis : ... 
    Publication: [Boston, Massachusetts] : Institute for Clinical and Economic Review, August 3, 2018
    ... immunomodulators could be compared to other systemic therapies like methotrexate ... sequences of targeted immunomodulator therapy should be evaluated to ...
  10. NLM Digital Collections - Carlsbad waters 
    Publication: [New York?] : s.n., [1850?]
    ... and their accommodations, including the table, are first-class, and they are not yet crowded, like most of the older lines of Atlantic steamers—a circumstance of no little con- sequence to the invalid, especially when he is accompanied ...
first · previous · 1 · 2 · 3 · 4 · 5 · 6 · 7 · 8 · 9 · 10 · next · last