- NLM Digital Collections - The Molecular Genetics of Cellular OncogenesPublication: Annual Reviews, Inc., 1984... implying that the enzymes involved in heavy chain class switches participate in translocations. Fortuitous S-like sequences may also influence the sites of recombination within ...
- NLM Digital Collections - Minireview: Unusual Reverse TranscriptasesPublication: American Society for Biochemistry and Molecular Biology, 20 October 1995... indi- cate that the RTases encoded by the class II retrotransposons and retroelements (called here type 2 RTases) are more like one another in predicted amino acid sequence than they are like the RTases (type 1) ...
- NLM Digital Collections - Annual report of Program Placement and Psychological Branch, Convalescent Services Division, ....Publication: Miami Beach, Florida : Army Air Forces Regional and Convalescent Hospital, Miami District... group psychotherapy. Its planned syllabus, regular number and sequence of sessions, combination of lectures followed by discussion, and heterogeneous composition tend to make it class-like, The informal atmosphere, attempt +-o draw out patients, ...
- NLM Digital Collections - Inquiries concerning the intellectual powers, and the investigation of truthPublication: Hartford : F.J. Huntington, 1833... circumstances. These refer chiefly to that uni- form sequence of events from which we derive our idea of the one being the cause of the other. But the class like- wise includes other relations arising out of the ...
- ... 86 nt long, is synthesized from the short class II] transcriptional unit located on the 5'-side of the Alu repeat (3). This location coincides with the location of the HY3-like DNA sequence. promoter? GTGG-CNNAGTGG HY3 GGCTGGTCCGAGTGCAGTGGTGTTTACAACTAAT TGATCACAACCAGTTA 50 ERKEKKES | ...
- NLM Digital Collections - [BIONET annual progress report] (pages 51-74)Publication: Produced: [1988-1989]... 86 nt long, is synthesized from the short class II] transcriptional unit located on the 5'-side of the Alu repeat (3). This location coincides with the location of the HY3-like DNA sequence. promoter? GTGG-CNNAGTGG HY3 GGCTGGTCCGAGTGCAGTGGTGTTTACAACTAAT TGATCACAACCAGTTA 50 ERKEKKES | ...
- NLM Digital Collections - Targeted immunomodulators for the treatment of moderate-to-severe plaque psoriasis : ...Publication: Boston, MA : Institute for Clinical and Economic Review, December 2 2016... immunomodulators could be compared to other systemic therapies like ... sequences of targeted immunomodulator therapy should be evaluated to ...
- NLM Digital Collections - Targeted immunomodulators for the treatment of moderate-to-severe plaque psoriasis : ...Publication: [Boston, Massachusetts] : Institute for Clinical and Economic Review, August 3, 2018... immunomodulators could be compared to other systemic therapies like methotrexate ... sequences of targeted immunomodulator therapy should be evaluated to ...
- ... and their accommodations, including the table, are first-class, and they are not yet crowded, like most of the older lines of Atlantic steamers—a circumstance of no little con- sequence to the invalid, especially when he is accompanied ...
- ... What we now seek is a system which, like DNA, permits a second class of interaction between the monomers, some form of weak bonding (hydrogen bonding; van der Waals, or whatever) so that an existing polymeric sequence can orient the choice of the next condensing ...